View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_61 (Length: 371)
Name: NF13254_low_61
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 75 - 350
Target Start/End: Complemental strand, 16987427 - 16987152
Alignment:
| Q |
75 |
gattgatgaatcactttatagtactttatttaatttgataaatgaaaaacatgaagtagagagaagtatgaaaatttaatcatttttatgaccattattt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16987427 |
gattgatgaatcactttatagtactttatttaatttgataaatgaaaaacatgaagtagagagaagtatgaaaatttaataatttttatgaccattattt |
16987328 |
T |
 |
| Q |
175 |
ataacactcacatttagatttagataaggattataaaagaagaagttcacctaaactgagcaaaatagattttagtttcttttttcctttgtttctgact |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16987327 |
ataacactcacatttagatttagataaggattataaaagaagaagttcacctaaactgagcaaaatagattttagtttcttttctcctttgtttctgact |
16987228 |
T |
 |
| Q |
275 |
tgctgatgtagaaagtagctggaagcttgacagagaagctccttgtttgttcctgctttttcttctgtgtttggtt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16987227 |
tgctgatgtagaaagtagctggaagcttgacagagaagctccttgtttgttcctgctttttcttctgtgtttggtt |
16987152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University