View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_64 (Length: 364)
Name: NF13254_low_64
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 362
Target Start/End: Complemental strand, 8316416 - 8316055
Alignment:
| Q |
1 |
cttggtaatggatgatgtccatcgattcatccagctcttggacaacgcacaagtccgaacaacatcttttgtagggaggaaagacagaacgcgatttata |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316416 |
cttggtgatggatgatgtccatcgattcatccatctcttggacaacacacaagtccgaacaacatcttttgtagggaggaaagacagaacgcgatttata |
8316317 |
T |
|
| Q |
101 |
agtgattcaggtagcttgctgttgatcgtgtcttcttcaattacacttgccatttgagtactcttgtgaaccttacttgaaccagcctccatgttactta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316316 |
agtgattcaggtagcttgctgttgatcgtgtcttcttcaattacacttgccatttgagtactcttgtgaaccttacttgaaccagcctccatgttactta |
8316217 |
T |
|
| Q |
201 |
ctgcaatttcaataccagttagtataagtcctccttggtatctttgaaacttaaattacatatcttgagatcatttgcatattatgttctacaagataaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8316216 |
ctgcaatttcaataccagttagtataagtcctccttggtatctttgaaacttaaattacatatcttgagatcatttgcatattatgttctacaagataaa |
8316117 |
T |
|
| Q |
301 |
ctcctgtattaggaatgttcaggcgttatatcatattatcagtaatgtccatatcgtctctg |
362 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
8316116 |
ctcatgtattaggaatgttcaggctttatatcatattatcagtaatgtccatgtcgtgtctg |
8316055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 86
Target Start/End: Original strand, 8359390 - 8359447
Alignment:
| Q |
29 |
atccagctcttggacaacgcacaagtccgaacaacatcttttgtagggaggaaagaca |
86 |
Q |
| |
|
||||| |||||||||||| ||||||| |||||| |||||||||| || || ||||||| |
|
|
| T |
8359390 |
atccatctcttggacaacacacaagttcgaacagcatcttttgtcggaagtaaagaca |
8359447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University