View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_65 (Length: 363)
Name: NF13254_low_65
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 227 - 347
Target Start/End: Complemental strand, 50746649 - 50746532
Alignment:
| Q |
227 |
aatgaaatgaaatgaaggaagagattgattgatatatatctcttacttcgtctctgcgtgtgatatgatatttcagagttccgtttactcggctacttat |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50746649 |
aatgaaatgaaatgaaggaagagattgattgatatatatctcttacttcgtctctgcgtgtg-----atatttcagagttccgtttactcggctacttat |
50746555 |
T |
 |
| Q |
327 |
g--catatatttatcaataaaaa |
347 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
50746554 |
gtatatatatttatcaataaaaa |
50746532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 9 - 141
Target Start/End: Complemental strand, 50746868 - 50746741
Alignment:
| Q |
9 |
gaagaaaattcggacaggtagaactggattttcgggtgatgttnnnnnnnnnnnnnnntccacagaaaataaaggaacaagctcttaataatttcttcac |
108 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50746868 |
gaagaaaattcggacaggtagaactgaattttcgggtgatgttaaaaaaaaaa-----tccacagaaaataaaggaacaagctcttgataatttcttcac |
50746774 |
T |
 |
| Q |
109 |
tttggcgtgaagggatagatataataacaaatc |
141 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
50746773 |
tttggcgtgaagggataaatataataacaaatc |
50746741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University