View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13254_low_65 (Length: 363)

Name: NF13254_low_65
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13254_low_65
NF13254_low_65
[»] chr3 (2 HSPs)
chr3 (227-347)||(50746532-50746649)
chr3 (9-141)||(50746741-50746868)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 227 - 347
Target Start/End: Complemental strand, 50746649 - 50746532
Alignment:
227 aatgaaatgaaatgaaggaagagattgattgatatatatctcttacttcgtctctgcgtgtgatatgatatttcagagttccgtttactcggctacttat 326  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||    
50746649 aatgaaatgaaatgaaggaagagattgattgatatatatctcttacttcgtctctgcgtgtg-----atatttcagagttccgtttactcggctacttat 50746555  T
327 g--catatatttatcaataaaaa 347  Q
    |   |||||||||||||||||||    
50746554 gtatatatatttatcaataaaaa 50746532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 9 - 141
Target Start/End: Complemental strand, 50746868 - 50746741
Alignment:
9 gaagaaaattcggacaggtagaactggattttcgggtgatgttnnnnnnnnnnnnnnntccacagaaaataaaggaacaagctcttaataatttcttcac 108  Q
    |||||||||||||||||||||||||| ||||||||||||||||               |||||||||||||||||||||||||||| |||||||||||||    
50746868 gaagaaaattcggacaggtagaactgaattttcgggtgatgttaaaaaaaaaa-----tccacagaaaataaaggaacaagctcttgataatttcttcac 50746774  T
109 tttggcgtgaagggatagatataataacaaatc 141  Q
    ||||||||||||||||| |||||||||||||||    
50746773 tttggcgtgaagggataaatataataacaaatc 50746741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University