View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_73 (Length: 335)
Name: NF13254_low_73
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_73 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 119 - 274
Target Start/End: Original strand, 629099 - 629254
Alignment:
| Q |
119 |
atatattacgaaacacttgacacacgaaagacaaaaatgtataatggttatcttgattgtttataatgtctacagcaaaatttgagtttgttattgacac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629099 |
atatattacgaaacacttgacacacgaaagagaaaaatgtataatggttatcttgattgtttataatgtctacagcaaaatttgagtttgttattgacac |
629198 |
T |
|
| Q |
219 |
aaatgaatagtgttgtatgaaatagaatgataaagcgcttgttggtttctcaaggc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629199 |
aaatgaatagtgttgtatgaaatagaatgataaagcgcttgttggtttctcaaggc |
629254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 18 - 122
Target Start/End: Original strand, 628962 - 629068
Alignment:
| Q |
18 |
tcaatatgacatcaaagttgatttgaaattatattttccttttctttgagggagaatgaacatcaatat--aacatgtataaataaatatttagagatac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
628962 |
tcaatatgacatcaaagttgatttgaaattatattttccttttctttgagggagaatgaacatcaatataaaatatatataaataaatatttagagatac |
629061 |
T |
|
| Q |
116 |
taaatat |
122 |
Q |
| |
|
||||||| |
|
|
| T |
629062 |
taaatat |
629068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University