View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_77 (Length: 317)
Name: NF13254_low_77
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 43366778 - 43366481
Alignment:
| Q |
1 |
tgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcacattccggtaatcaaacaatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366778 |
tgtgtaactttgattgtatttcaggataatgatttggttaaatctcgtttagattctcatcagcaatccccatttcacattccggtaatcaaacaatgtt |
43366679 |
T |
|
| Q |
101 |
ctcaccttcnnnnnnnatgcattttttgttatgttgctaatatcttccttttgtttcttcgaatttgaagacaagtgaaggtacttacaagcatgatcta |
200 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366678 |
ctcacctt---tttttattcattttttgttatgttgctaatatcttccttttgtttcttcgaatttgaagacaagtgaaggtacttacaagcatgatcta |
43366582 |
T |
|
| Q |
201 |
tggaattcgaggaactcgcagcttttctctgcctgcagtaatgccggtgtcaactttgcaagtaaacttcatcctagactcctagctagtccttttttca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43366581 |
tggaattcgaggaactcgcagcttttctctgcctgcagttatgccggtgtcaactttgcaagtaaacttcatcctagactc----ctagtccttttttca |
43366486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University