View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_86 (Length: 286)
Name: NF13254_low_86
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_86 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 9624850 - 9625021
Alignment:
| Q |
1 |
gatgaagtagatgaaacaacattgacaacaaatgaagaattagcaaatacagaagaactaaacagaaaatttgaagaattcataaggaaaatgaaagagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9624850 |
gatgaagtagatgaaacaacattgacaacaaatgaagaattagcaaatacagaagaactaaacagaaaatttgaagaattcataaggaaaatgaaagagg |
9624949 |
T |
 |
| Q |
101 |
agatgaggattgaagctcaaacacacctcattgcagtttaacaaccttcttctaattaagtactttagtctc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9624950 |
agatgaggattgaagctcaaacacaccttattgcagtttaacaaccttcttctaattaagtgctttagtctc |
9625021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University