View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13254_low_86 (Length: 286)

Name: NF13254_low_86
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13254_low_86
NF13254_low_86
[»] chr2 (1 HSPs)
chr2 (1-172)||(9624850-9625021)


Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 9624850 - 9625021
Alignment:
1 gatgaagtagatgaaacaacattgacaacaaatgaagaattagcaaatacagaagaactaaacagaaaatttgaagaattcataaggaaaatgaaagagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9624850 gatgaagtagatgaaacaacattgacaacaaatgaagaattagcaaatacagaagaactaaacagaaaatttgaagaattcataaggaaaatgaaagagg 9624949  T
101 agatgaggattgaagctcaaacacacctcattgcagtttaacaaccttcttctaattaagtactttagtctc 172  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||    
9624950 agatgaggattgaagctcaaacacaccttattgcagtttaacaaccttcttctaattaagtgctttagtctc 9625021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University