View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_92 (Length: 268)
Name: NF13254_low_92
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 34786330 - 34786105
Alignment:
| Q |
1 |
aaagaaacacatccaaagtattatactacatacctttctaagtggaattaagacaaagagtccaacaaagcaaacaacaaaaaggaagccagacatccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34786330 |
aaagaaacacatccaaagtattatattacatacctttctgagtggaattaagacaaagagtccaacaaagcaaacaacaaaaaggaagccagacatccaa |
34786231 |
T |
|
| Q |
101 |
ccaaatgcaggttctttaactgcgcttgggttgttaccctcagtgcctactccagacaatatatatgttttcctgtttaatcccaacagataagaagcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34786230 |
ccaaatgcaggttctttaactgcgcttgggttgttaccctcagtgcctactccagacaatatatatgtcttcctgtttaatcccaacagataagaagcaa |
34786131 |
T |
|
| Q |
201 |
atcctccggcaacaaacacaagcaca |
226 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
34786130 |
atcctcctgcaacaaacacaagcaca |
34786105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University