View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13254_low_94 (Length: 263)
Name: NF13254_low_94
Description: NF13254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13254_low_94 |
 | |
|
| [»] scaffold1099 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1099 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 99 - 233
Target Start/End: Complemental strand, 2895 - 2761
Alignment:
| Q |
99 |
gttttctcttctcgatgttcctagaacccttagtagataagtttttgtctatttgtatattctaattccaggcagcaacataagatgtagctattcttaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2895 |
gttttctcttctcgatgttcctagaacccttagtagataagtttttgtctatttgtatattctaattccaggcagcaacataagatgtagctattcttaa |
2796 |
T |
|
| Q |
199 |
tgacatttaatgtgcattcacgcaatgctaaagaa |
233 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
2795 |
tgacattttatgtgcattcacgcaatgctaaagaa |
2761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 64 - 193
Target Start/End: Complemental strand, 55824774 - 55824645
Alignment:
| Q |
64 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcgatgttcctagaacccttagtagataagtttttgtctatttgtatattctaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55824774 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcaatgttcctagaacccttagtagataagtttttgtctatttgtatattctaa |
55824675 |
T |
|
| Q |
164 |
ttccaggcagcaacataagatgtagctatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55824674 |
ttccaggcagcaacataagatgtagctatt |
55824645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 64 - 193
Target Start/End: Original strand, 56150207 - 56150336
Alignment:
| Q |
64 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcgatgttcctagaacccttagtagataagtttttgtctatttgtatattctaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56150207 |
ttgtgcaaatacgatttctcattgttaacatgctggttttctcttctcaatgttcctagaacccttagtagataagtttttgtctatttgtatattctaa |
56150306 |
T |
|
| Q |
164 |
ttccaggcagcaacataagatgtagctatt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
56150307 |
ttccaggcagcaacataagatgtagctatt |
56150336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University