View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13255_high_18 (Length: 242)
Name: NF13255_high_18
Description: NF13255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13255_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 35 - 203
Target Start/End: Complemental strand, 21404403 - 21404235
Alignment:
| Q |
35 |
aaatgttaaagacttgctaaagttagatatcaatatttacattttatctgtctcaaatttttgttggtaattcaacctttttagaagtaactcaaaagtt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21404403 |
aaatgttaaagacttgctaaagttagatatcaatatttacattttatctgtctcaaatttttgttggtaattcaacctttttagaagtaactcaaaagtt |
21404304 |
T |
 |
| Q |
135 |
gccctagaaaaaggtaactcataaattcgattcttctgttaaattaaatttttgttatatatatgagaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21404303 |
gccctagaaaaaggtaactcataaattcgattcttctgttaaattaaatttttgttatatgtatgagaa |
21404235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University