View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13255_high_20 (Length: 203)
Name: NF13255_high_20
Description: NF13255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13255_high_20 |
 |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 46844061 - 46843889
Alignment:
| Q |
18 |
aaacatacactcagaaagctctcagagggatagctggtagggtgaggaaaacaatacccattctctttaacagcagagcatccaatatcaaaacaactac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46844061 |
aaacatacactcagaaagctctcagagggatagctggtagggtgaggaaaacaatacccattctctttaacagcagagcatccaatatcaaaacaactac |
46843962 |
T |
 |
| Q |
118 |
tctcaattatgcaattatcaaatatatgagttgttcttgggtttggaccatgagaaatcacacgagtataatc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843961 |
tctcaattatgcaattatcaaatatatgagttgttcttgggtttggaccatgagaaatcacacgagtataatc |
46843889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 129 - 180
Target Start/End: Complemental strand, 31876167 - 31876116
Alignment:
| Q |
129 |
caattatcaaatatatgagttgttcttgggtttggaccatgagaaatcacac |
180 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| ||||||| |
|
|
| T |
31876167 |
caattatcaaatatatgagttgtttttgggtttggtccatgagatatcacac |
31876116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 190
Target Start/End: Complemental strand, 28507 - 28421
Alignment:
| Q |
104 |
atcaaaacaactactctcaattatgcaattatcaaatatatgagttgttcttgggtttggaccatgagaaatcacacgagtataatc |
190 |
Q |
| |
|
|||||||||| |||||| |||||| || |||||| |||| |||||||||||||| ||||| ||||| ||||||||| ||||||||| |
|
|
| T |
28507 |
atcaaaacaattactcttaattatacagttatcatatatttgagttgttcttggttttggttcatgaaaaatcacacaagtataatc |
28421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 102
Target Start/End: Original strand, 28151 - 28230
Alignment:
| Q |
26 |
actcagaaagctctcagagggatagctggtagggtgaggaaaacaatacccattctctttaac---agcagagcatccaa |
102 |
Q |
| |
|
||||| ||||||||||||||||| || ||| | ||| |||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
28151 |
actcaaaaagctctcagagggatgactagtacgatgaagaaaaccatacccattttctttaacagaagcagagcatccaa |
28230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University