View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13255_low_10 (Length: 405)
Name: NF13255_low_10
Description: NF13255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13255_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 320
Target Start/End: Original strand, 43193528 - 43193847
Alignment:
| Q |
1 |
ccatggcatgttccttgtttacctctgattccaacctcaatcctcgattgggaatgctccgattgttctcaacccgtcgccggcgattccgctgctccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193528 |
ccatggcatgttccttgtttacctctgattccaacctcaatcctcgattgggaatgctccgattgttctcaacccgtcgccggcgattccgctgctccgt |
43193627 |
T |
 |
| Q |
101 |
ctgttgccggagatctcgtttccgctattcgcgccattgagaacgatgtttcgcttaccgatgatgaaaaagcgaagaaacgacaagaactcgttggtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193628 |
ctgttgccggagatctcgtttccgctattcgcgccattgagaacgatgtttcgcttaccgatgatgaaaaagcgaagaaacgacaagaactcgttggtgg |
43193727 |
T |
 |
| Q |
201 |
gacttctaattcacctgctgaaacaaacaatagacgcagtaacggtttgcttgatatcttcgatggtagccttaactgttccttctgcatccagctgcct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43193728 |
gacttctaattcacctgctgaaacaaacaatagacgcagtaacggcttgcttgatatcttcgatggtagccttaactgttccttctgcatccagttgcct |
43193827 |
T |
 |
| Q |
301 |
gagagacctgttactgttag |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43193828 |
gagagacctgttactgttag |
43193847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University