View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13255_low_13 (Length: 264)
Name: NF13255_low_13
Description: NF13255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13255_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 43193312 - 43193551
Alignment:
| Q |
17 |
aaaatttccctccttataaataggggcatnnnnnnnn--tcagaagaggaaaagagaggaaaacgaaaacctaaccaaccaattacaaatccagtgagtg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193312 |
aaaatttccctccttataaataggggcataaaaaaaaaatcagaagaggaaaagagaggaaaacgaaaacctaaccaaccaattacaaatccagtgagtg |
43193411 |
T |
 |
| Q |
115 |
acattttaccaacccaaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattg |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193412 |
acattttaccaactcaaatggcgaagcagctaccttgtgacgccgatggtgtttgcatggcgtgtaaaacgaagcctctagaaactgaaacccttcattg |
43193511 |
T |
 |
| Q |
215 |
tcgaacatgtgcaactccatggcatgttccttgtttacct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43193512 |
tcgaacatgtgcaactccatggcatgttccttgtttacct |
43193551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University