View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13256_high_5 (Length: 350)
Name: NF13256_high_5
Description: NF13256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13256_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 5 - 333
Target Start/End: Complemental strand, 2345999 - 2345674
Alignment:
| Q |
5 |
agcagagaccaaaagtcatgataaaaaacatttaggagatcaaaacttggtnnnnnnnnnntttaggggggtcaaaaacgaaatttgagatttttatagg |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2345999 |
agcagagaccaaaagtcgtgataaaaaacatttaggagatcaaaacttggtaaaaaaaa---ttaggggggtcaaaaacgaaatttgagatttttatagg |
2345903 |
T |
 |
| Q |
105 |
gatcaaaggtcttattaaaccctaaaacaaattactctaaggttacgttgttttaaggaaacaacaataataaatagatatcttttattttcttactcac |
204 |
Q |
| |
|
||| || |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||| |||||||||||||||||||||| ||| |
|
|
| T |
2345902 |
gatttaaagtcttattaaaccctaaaacaaattactctaaggttacattgctttaaggaaacaacaatgataagtagatatcttttattttcttacgcac |
2345803 |
T |
 |
| Q |
205 |
tttcaacaactcattttctctctatctttctcgtcctatcacattgacaaactatcatatctatcacatcactctcattttctcattggaaattatttct |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2345802 |
tttcaacaactcattttctctctatctttctcgtcctatcctattgacaaactatcatatctatcacatcactctcattttctcattggaaattatttct |
2345703 |
T |
 |
| Q |
305 |
agctagtacattttacagctattgcaact |
333 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2345702 |
agctagtacattttacagctattgcaact |
2345674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University