View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13258_high_12 (Length: 215)
Name: NF13258_high_12
Description: NF13258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13258_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 22 - 158
Target Start/End: Complemental strand, 46598782 - 46598646
Alignment:
| Q |
22 |
ctttctgttattactttagtttaaggaaatttatttaattactctgcacttggattttgtcctacaaactcagatttcaattctctttctggattattat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46598782 |
ctttctgttattactttagtttaaggaaatttatataattactctgcacttggattttgtcctacaaactcagatttcaattctctttctggattattat |
46598683 |
T |
|
| Q |
122 |
tagtactctaagctaagcattgatactttaattttaa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46598682 |
tagtactctaagctaagcattgatactttaattttaa |
46598646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 164 - 202
Target Start/End: Complemental strand, 46598621 - 46598583
Alignment:
| Q |
164 |
tactattactgttttatatttgtaaatagctgaatattg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46598621 |
tactattactgttttatatttgtaaatagctgaatattg |
46598583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University