View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13259_high_26 (Length: 249)
Name: NF13259_high_26
Description: NF13259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13259_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 236
Target Start/End: Original strand, 15228265 - 15228481
Alignment:
| Q |
20 |
attaaataggaaacggttccattattcaaccacattatgtaacaatacatttattaaaatactagcttgtcattcaactcattaaacttctatgcagcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15228265 |
attaaataggaaacggttccattattcaaccacattatgtaacaatacatttattaaaatactagcttgtcattcaactcattaaacttctatgcagcaa |
15228364 |
T |
|
| Q |
120 |
gtgattgaacatactcatccacctcaatgaagttcttgactgcaaaatctttgacaatacttggatcaggaatatcattactaactttaacatactcagc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15228365 |
gtgattgaacatactcatccacctcaatgaagttcttgactgcaaaatttttgacaatacttggatcaggaatatcattactaactttaacatactcagc |
15228464 |
T |
|
| Q |
220 |
acaccatttcatctcac |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15228465 |
acaccatttcatctcac |
15228481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University