View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13259_high_31 (Length: 208)
Name: NF13259_high_31
Description: NF13259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13259_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 24927584 - 24927411
Alignment:
| Q |
18 |
atggttaggaatcaaattgggtcttcaagtaaaaagaatgttgagtagtgctttgtttaagtgagttgtgatgaataattaagtgtttcattacagtgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24927584 |
atggttaggaatcaaattgggtcttcaagtaaaaagaatgttgagtagtgctttgtttaagtgagttgtgatgaataattaagtgtttcattacagtgaa |
24927485 |
T |
|
| Q |
118 |
gaatagaagtgatttaggatctagcagaatttgatgtatcatacattgtgaaattttactcaaattccacatgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24927484 |
gaatagaagtgatttaggatctagcagaatttaatgtatcatacattgtgaaattttactcaaattccacatgt |
24927411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University