View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13259_low_29 (Length: 250)
Name: NF13259_low_29
Description: NF13259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13259_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 31870669 - 31870908
Alignment:
| Q |
1 |
tcggtacacgaaagcagaaaaagtaatgcgactcatcaaccttcacagcagcttcatccttagcaagcggccattgaatctcattgccgacacgagcgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870669 |
tcggtacacgaaagcagaaaaagtaatgcgactcatcaaccttcacagcagcttcatccttagcaagcggccattgaatctcattgccgacacgagcgta |
31870768 |
T |
|
| Q |
101 |
aacagctacggtgttattcccctgccggagacgaatgatggtgagatcaccgatagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870769 |
aacagctacggtgttattcccctgccggagacgaatgatggtgagatcactgatagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcg |
31870868 |
T |
|
| Q |
201 |
ccggggattttgatgaggatatcttctgcggcgatctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870869 |
ccggggattttgatgaggatatcttctgcggcgatctgtg |
31870908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 8851051 - 8850963
Alignment:
| Q |
126 |
cggagacgaatgatggtgagatcaccgatagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgat |
214 |
Q |
| |
|
|||||||| | || ||||| |||||| ||||||||| | ||||||||||||||| || |||| |||||||| |||||||||||||| |
|
|
| T |
8851051 |
cggagacggacgacggtgaagtcaccggaagcaagttcaacgctgtattgttgatcgatgaggttgagaatggctccggggattttgat |
8850963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University