View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1325R-Insertion-10 (Length: 297)
Name: NF1325R-Insertion-10
Description: NF1325R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1325R-Insertion-10 |
 | |
|
| [»] scaffold0152 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0152 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 269
Target Start/End: Original strand, 11123 - 11376
Alignment:
| Q |
9 |
acaaggagtattcctaatcttttttccttcttttcatcatacagacccttgcttatagtggattttgtgagctcacgcttgatatagcggcgatgcctgc |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11123 |
acaaggagtattcctaatattttttccttcttttcatcatacagacccttgcttatagtggattttgtgagctcacgcttgatatagcg---atgcctgc |
11219 |
T |
|
| Q |
109 |
gctgaagatggtagatgactgtgaaaatttgtgggagtgtactctggtctttgagagacgtccttatgttcagtttaaaattgatagtggtttttcaatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11220 |
gctgaagatggtagatgactgtgaaaatttgtgggagtgtactctggtctttgagagacgtccttatgttcagtttaaaattgatagtgg--tttcaatc |
11317 |
T |
|
| Q |
209 |
gaatggttcttgctagaaaggctttgtgaaggttctaatgtgatggtttggtgcacaggtt |
269 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
11318 |
gaatggttcttgctag-aaggctttgtgaaggttctaatgtgatgg-ttggtgcaccggtt |
11376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 9 - 97
Target Start/End: Complemental strand, 2888963 - 2888876
Alignment:
| Q |
9 |
acaaggagtattcctaatcttttttccttcttttcatcatacagacccttgcttatagtggattttgtgagctcacgcttgatatagcg |
97 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2888963 |
acaaggagtattcctaatattttttccttcttttcatcatacagaccctt-cttatagtggattttgtgagctcacgcttgatatagcg |
2888876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University