View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1325R-Insertion-13 (Length: 190)
Name: NF1325R-Insertion-13
Description: NF1325R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1325R-Insertion-13 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 104 - 190
Target Start/End: Complemental strand, 27984442 - 27984352
Alignment:
| Q |
104 |
aatatgtttgtggtattgcttcacacttagatataagtttgtt----gttatagttgcttaagactactttattcattgattatactaatt |
190 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27984442 |
aatatgtttgtgttattgcttcacacttagatataagtttgtttgttgttatcgttgcttaagactactttattcattgattatactaatt |
27984352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 68
Target Start/End: Complemental strand, 27984566 - 27984509
Alignment:
| Q |
11 |
ctttctccagagagtatgtcttattggaccgaactggataaacagtaacggtgtgtag |
68 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| || || ||||||| |
|
|
| T |
27984566 |
ctttctccccagagtatgtcttattggactgaactggataaacaatatcgatgtgtag |
27984509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 106 - 182
Target Start/End: Complemental strand, 99109 - 99034
Alignment:
| Q |
106 |
tatgtttgtggtattgcttcacacttagatataagtttgttgttatagttgcttaagactactttattcattgatta |
182 |
Q |
| |
|
|||||||| ||| || ||| |||||| |||||| ||||||| || | |||||||||||||||||| |||||||||| |
|
|
| T |
99109 |
tatgtttgcggtgtttctttacacttggatatatgtttgtt-ttgttgttgcttaagactactttgctcattgatta |
99034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University