View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1325R-Insertion-15 (Length: 176)
Name: NF1325R-Insertion-15
Description: NF1325R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1325R-Insertion-15 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 8e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 8e-29
Query Start/End: Original strand, 98 - 174
Target Start/End: Original strand, 51458591 - 51458667
Alignment:
| Q |
98 |
ttcctttaaagcaggtagaaccggcttagacaattttccattatctagttatagggatgcccctcatgaccatttac |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
51458591 |
ttcctttaaagcaggtagaaccggcttagacaattttccattatctagctctatggatgcccctcatgaccatttac |
51458667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 43162862 - 43162939
Alignment:
| Q |
99 |
tcctttaaagcaggtagaaccggcttagacaattttccattatctagttatagggatgcccctcatgaccatttactt |
176 |
Q |
| |
|
|||||||||||||||| || | ||||||||||||||||||||||||| | || ||||||||||| ||| ||||||||| |
|
|
| T |
43162862 |
tcctttaaagcaggtaaaatcagcttagacaattttccattatctagctctatggatgcccctcgtgatcatttactt |
43162939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 31 - 81
Target Start/End: Complemental strand, 34899952 - 34899901
Alignment:
| Q |
31 |
accaaaatttacctatatg-atagaaacacatctctctttagttcgtctctc |
81 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||||||||||||| |||||| |
|
|
| T |
34899952 |
accaaactttacctatatgcatataaacacatctctctttagttcttctctc |
34899901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University