View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1325R-Insertion-7 (Length: 507)
Name: NF1325R-Insertion-7
Description: NF1325R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1325R-Insertion-7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 4e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 31928748 - 31928538
Alignment:
| Q |
19 |
aatgtgaacaaattcaactgaccaatattctgtaaccaacggttattgagagaacatgcaaagggggatataactagcactaaagattaacggttccaag |
118 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||| ||||||||| ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
31928748 |
aatgtgaacaaattccactgaccaata-------accaacggttattgagataacatgcaatgggatatataactagcactaaggattaacggttccaag |
31928656 |
T |
|
| Q |
119 |
caaa-tttgcaacaataacaaaagttgcagctcaaaagtggacccagtatagcaaaacaaccgatgatattgtatattgtaatggaaattttcgacttta |
217 |
Q |
| |
|
|||| ||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| ||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
31928655 |
caaaatttgcaataataacaaaagttgcagttcaaaagtagacccagtatagcaaaggaaccaatgatattgtaaattgtaatggaaatttccaacttta |
31928556 |
T |
|
| Q |
218 |
attgattattcctttttt |
235 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
31928555 |
attgataattcctttttt |
31928538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 432 - 507
Target Start/End: Complemental strand, 31928398 - 31928321
Alignment:
| Q |
432 |
tatttaggtattttgggttaga--gttaatgaattaaggtttagccataagtctcctttttatggggaattattaggg |
507 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31928398 |
tatttaggtattttggggtagaaagtgaatgaattaaggtttagccataagtctcctttttatggggaagtattaggg |
31928321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University