View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326-Insertion-27 (Length: 196)
Name: NF1326-Insertion-27
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326-Insertion-27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 7 - 195
Target Start/End: Original strand, 45264749 - 45264936
Alignment:
| Q |
7 |
atatatattactcttctttaattgataatattgttttannnnnnnattgcattaagcttgccataaactaaactagtaacattatttgaaaggagtaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264749 |
atatatattactcttctttaattgataatattgttttatttttttattgcattaagcttgccataaactaaactagtaacattatttgaaaggagtaaga |
45264848 |
T |
|
| Q |
107 |
agaacttggcaattccacaatcagccatttttagctatttgaatggtggaagggattcccattcttattgattactctgtccctttttt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264849 |
agaacttggcaattccacaatcagccatttttagctatttgaatggtggaa-agattcccattcttattgattactctgtccctttttt |
45264936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University