View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1326-Insertion-31 (Length: 403)
Name: NF1326-Insertion-31
Description: NF1326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1326-Insertion-31 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 392; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 8 - 403
Target Start/End: Complemental strand, 28721111 - 28720716
Alignment:
| Q |
8 |
ctttcaacccgctggaccccactatgctactccctcaccactctccgttttgacgacgaacctgtcaaaaactacgaagagttccatcgcttctgtcgtt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28721111 |
ctttcaacccgctggaccccactatgctactccctcaccactctccgttttgacgacgaacctgtcaaaaactacaaagagttccatcgcttctgtcgtt |
28721012 |
T |
|
| Q |
108 |
tcatcgacacactcatgctctctcctcaagtatcacaccaatccctcaaaacgttttacctcaagtgttgttttggaatttacgaagctgatcttcgaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28721011 |
tcatcgacacactcatgctctctcctcaagtatcacaccaatccctcaaaacgttttacctcaagtgttgttttggaatttacgaagctgatcttcgaag |
28720912 |
T |
|
| Q |
208 |
cttcgacgcatgggttgaagctgctaaacgacgcagcgttgaggaatttcatcttatcatgaatgagcacactttgaatcccgcaattttcacctctcaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28720911 |
cttcgacgcatgggttgaagctgctaaacgacgcagcgttgaggaatttcatcttatcatgaatgagcacactttgaatcccgcaattttcacctctcaa |
28720812 |
T |
|
| Q |
308 |
accctagttgttttgaaacttgaaaaggttcaagttgaagcggaaactctgtgtgttgatcttccgttgcttaaaacgctgcatttgaaatatgtt |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28720811 |
accctagttgttttgaaacttgaaaaggttcaagttgaagcggaaactctgtgtgttgatcttccgttgcttaaaacgctgcatttgaaatatgtt |
28720716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 281 - 372
Target Start/End: Original strand, 15498038 - 15498129
Alignment:
| Q |
281 |
ttgaatcccgcaattttcacctctcaaaccctagttgttttgaaacttgaaaaggttcaagttgaagcggaaactctgtgtgttgatcttcc |
372 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| | |||| || | | | ||| ||||||| |||| | |||||||| ||||||| |
|
|
| T |
15498038 |
ttgaatcccacaattttcacctctcataccctagttgttctcaaacatgcgaggttacaacttgaagctgaaaatttgtgtgttcatcttcc |
15498129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 40208113 - 40208058
Alignment:
| Q |
281 |
ttgaatcccgcaattttcacctctcaaaccctagttgttttgaaacttgaaaaggt |
336 |
Q |
| |
|
||||||||| | |||||||| | |||||| |||||||||||||||||||| ||||| |
|
|
| T |
40208113 |
ttgaatcccaccattttcacttgtcaaactctagttgttttgaaacttgagaaggt |
40208058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 24112135 - 24112184
Alignment:
| Q |
281 |
ttgaatcccgcaattttcacctctcaaaccctagttgttttgaaacttga |
330 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
24112135 |
ttgaatcccataattttcacctctcaaaccctatttgttctcaaacttga |
24112184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 25613646 - 25613695
Alignment:
| Q |
281 |
ttgaatcccgcaattttcacctctcaaaccctagttgttttgaaacttga |
330 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
25613646 |
ttgaatcctacaattttcacctccaaaaccctagttgttctgaaacttga |
25613695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 31261806 - 31261855
Alignment:
| Q |
281 |
ttgaatcccgcaattttcacctctcaaaccctagttgttttgaaacttga |
330 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||| || |||||||||| |
|
|
| T |
31261806 |
ttgaatcccacaattttaacctcccaaaccctagttattctgaaacttga |
31261855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University