View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13260_high_29 (Length: 253)

Name: NF13260_high_29
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13260_high_29
NF13260_high_29
[»] chr5 (2 HSPs)
chr5 (104-224)||(27087609-27087729)
chr5 (1-39)||(27087506-27087544)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 104 - 224
Target Start/End: Original strand, 27087609 - 27087729
Alignment:
104 gtttagatgcatgatgaaattagaagataaatgttacacaaaaatatgatattttatttccctcttatcatataatatgatactacattcattggtttct 203  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||    
27087609 gtttagatgcatgatgatattagaagataaatgttacacaaaaatatgatattttatttcccccttatcatataatatgatactacattcattgttttct 27087708  T
204 aaaaacattattcattcccct 224  Q
    |||||||||||||||||||||    
27087709 aaaaacattattcattcccct 27087729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 27087506 - 27087544
Alignment:
1 tatggttgagttttagtctttgttagatttcgtaacatt 39  Q
    |||||||||||||||||||||||||||||||||||||||    
27087506 tatggttgagttttagtctttgttagatttcgtaacatt 27087544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University