View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13260_high_34 (Length: 237)
Name: NF13260_high_34
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13260_high_34 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 237
Target Start/End: Original strand, 17141721 - 17141942
Alignment:
| Q |
17 |
gatcacttgtccaatatcaattgtttataagagaaaattgtgtatcctcacgagcttt-gtcctctgaaccgactatgagactaatctttactcagacgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17141721 |
gatcacttgtccaatatcaattgtttataagagaaaattgtgtatcctcacaagcttttgtcctctgaaccgactatgagactaatctttgctcagacgt |
17141820 |
T |
 |
| Q |
116 |
taagattacatcctctgaaccgattatgagacttatctctactcagtcgttaagatcacatcttaaagtttttggtcccagtttaaaaatgtattatgcg |
215 |
Q |
| |
|
||| || ||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17141821 |
taaaatcgcatcctctgaaccgattatgaaacttatttctgctcagtcgttaagatcacatcttaaagtttttggtcccagtttaaaaatgtattatgtg |
17141920 |
T |
 |
| Q |
216 |
gagaaacattggttctatcccc |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
17141921 |
gagaaacattggttctatcccc |
17141942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University