View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13260_high_36 (Length: 219)

Name: NF13260_high_36
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13260_high_36
NF13260_high_36
[»] chr2 (2 HSPs)
chr2 (1-68)||(8518230-8518297)
chr2 (1-84)||(8526108-8526191)


Alignment Details
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 8518297 - 8518230
Alignment:
1 atgtataccattggtggtagtgctaactctaccattttcagtcaagcaaacttattcatagcttcaaa 68  Q
    |||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||    
8518297 atgtatgccattggtggtagtgctcaccctaccattttcagtcaagcaaacttattcatagcttcaaa 8518230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 8526191 - 8526108
Alignment:
1 atgtataccattggtggtagtgctaactctaccattttcagtcaagcaaacttattcatagcttcaaaagattctcatgcaaaa 84  Q
    |||||| ||||||||||||||||| || |||||||||||||||||||||| |  ||||||||||||||| ||||| ||||||||    
8526191 atgtatgccattggtggtagtgctgaccctaccattttcagtcaagcaaattacttcatagcttcaaaaaattctaatgcaaaa 8526108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University