View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13260_low_30 (Length: 253)
Name: NF13260_low_30
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13260_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 104 - 224
Target Start/End: Original strand, 27087609 - 27087729
Alignment:
| Q |
104 |
gtttagatgcatgatgaaattagaagataaatgttacacaaaaatatgatattttatttccctcttatcatataatatgatactacattcattggtttct |
203 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27087609 |
gtttagatgcatgatgatattagaagataaatgttacacaaaaatatgatattttatttcccccttatcatataatatgatactacattcattgttttct |
27087708 |
T |
|
| Q |
204 |
aaaaacattattcattcccct |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27087709 |
aaaaacattattcattcccct |
27087729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 27087506 - 27087544
Alignment:
| Q |
1 |
tatggttgagttttagtctttgttagatttcgtaacatt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27087506 |
tatggttgagttttagtctttgttagatttcgtaacatt |
27087544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University