View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13260_low_31 (Length: 246)
Name: NF13260_low_31
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13260_low_31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 35350 - 35121
Alignment:
| Q |
17 |
acaatgaatgaatgtgtgagagaaggtggctgaccaaaagtgaaaacatagccattgttggacatgagttgtttgttggcgatgataattccaacggagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35350 |
acaatgaatgaatgtgtgagagaaggtggctgaccaaaagtgaaaacatagccattgttggacatgagttgtttgttagcgatgataattccaacggagc |
35251 |
T |
|
| Q |
117 |
tgacaatgttcatcccccatgctccaacattagataaagatgcttttttctttactactacattctccattatatctctctatctataataataataaca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35250 |
tgacaatgttcatcccccatgctccaacattagataaagatgcttttttctttactactacattctccattatatctctctatctataataataataaca |
35151 |
T |
|
| Q |
217 |
acatcaacattaatcaatttgaaggataac |
246 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
35150 |
acaacaacattaatcaatttgaaggataac |
35121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 53 - 143
Target Start/End: Original strand, 8677443 - 8677533
Alignment:
| Q |
53 |
aaagtgaaaacatagccattgttggacatgagttgtttgttggcgatgataattccaacggagctgacaatgttcatcccccatgctccaa |
143 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||||| || || ||||||||||||||||| || |||| |||||| ||||||||||||| |
|
|
| T |
8677443 |
aaagtgaaagcatagccattgttggacataagctgtttattagccatgataattccaacggaactcacaacgttcataccccatgctccaa |
8677533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University