View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13260_low_37 (Length: 219)
Name: NF13260_low_37
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13260_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 8518297 - 8518230
Alignment:
| Q |
1 |
atgtataccattggtggtagtgctaactctaccattttcagtcaagcaaacttattcatagcttcaaa |
68 |
Q |
| |
|
|||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518297 |
atgtatgccattggtggtagtgctcaccctaccattttcagtcaagcaaacttattcatagcttcaaa |
8518230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 8526191 - 8526108
Alignment:
| Q |
1 |
atgtataccattggtggtagtgctaactctaccattttcagtcaagcaaacttattcatagcttcaaaagattctcatgcaaaa |
84 |
Q |
| |
|
|||||| ||||||||||||||||| || |||||||||||||||||||||| | ||||||||||||||| ||||| |||||||| |
|
|
| T |
8526191 |
atgtatgccattggtggtagtgctgaccctaccattttcagtcaagcaaattacttcatagcttcaaaaaattctaatgcaaaa |
8526108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University