View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13260_low_38 (Length: 215)
Name: NF13260_low_38
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13260_low_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 15296393 - 15296212
Alignment:
| Q |
12 |
tgagaagaatggagaaaaacgcatgccattgttacttccaatgttaatatacaacagagaagaagtcttttaactaagtacgttatgttacatgaatcaa |
111 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15296393 |
tgagaagaattgagaaaaatgcatggcattgttacttccaatgtttatatacaacagagaagaagtcttttaactaagtacggtatgttacatgaatcaa |
15296294 |
T |
 |
| Q |
112 |
acactataataccctatcataaatttgtgtttaaagggcatcatttaacaactctaaacccctctaaatgttttaatagagtcttc |
197 |
Q |
| |
|
|||| ||||| |||||| |||||||||||||||| |||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
15296293 |
acaccataatgccctattgtaaatttgtgtttaaa-ggcatcattt---aactctaaacttctctaaatgctttaatagagtcttc |
15296212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University