View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13260_low_40 (Length: 213)
Name: NF13260_low_40
Description: NF13260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13260_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 10 - 197
Target Start/End: Complemental strand, 42594102 - 42593915
Alignment:
| Q |
10 |
aatatatactgtctgctccggcacaaagtgaattcctaagtttattggtggtcgccaataatacctggtcaaaaaatcaaacaatagatttaaataatga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42594102 |
aatatatactgtctgctccggcacaaagtgaattccgaagtttatcggtggttgccaataatacctgatcaaaaaatcaaacaatagatttaaataatga |
42594003 |
T |
 |
| Q |
110 |
tattactattattattgcaaaacctcgttaaggaggataaatttaactaacacaggcttatgatcatagcggtgtcggctgttaaaac |
197 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42594002 |
tattactattattattgcaaaacctctttaaggagaataaatttaactaacacaggcttatgatcatagcggtgtcggctgttaaaac |
42593915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 42570226 - 42570186
Alignment:
| Q |
11 |
atatatactgtctgctccggcacaaagtgaattcctaagtt |
51 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
42570226 |
atatatactgtctgatccggcacaaagtgaattccaaagtt |
42570186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 51
Target Start/End: Complemental strand, 42577415 - 42577375
Alignment:
| Q |
11 |
atatatactgtctgctccggcacaaagtgaattcctaagtt |
51 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| ||||| |
|
|
| T |
42577415 |
atatacactgtctgctccggcacaaagttaattccaaagtt |
42577375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University