View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13261_high_28 (Length: 219)
Name: NF13261_high_28
Description: NF13261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13261_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 27 - 206
Target Start/End: Complemental strand, 25002946 - 25002767
Alignment:
| Q |
27 |
aacagcaaagagtttctttctagcgaggcatcgagggcggttaatggttggattgaagcatggaacaacgttatccaaattctgttgtggtggagaagag |
126 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25002946 |
aacagcgaaaagtttctttctagcgaggcatcgagggcggttaatggttgggttgaagcatggaacaacgttatccaaattctgttgtggtggagaagag |
25002847 |
T |
 |
| Q |
127 |
ggagaagaagttggtgagagttgagagagatctaataagttgatttgattttgcagtttcctgctggctttgatattctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25002846 |
ggagaagaagttggtgagagttgagagagatctaataagttgatttgattttgcagtttcctgctggctttgattttctt |
25002767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 34 - 206
Target Start/End: Original strand, 24998616 - 24998791
Alignment:
| Q |
34 |
aagagtttctttctagcgaggcatcgagggcggttaatggttggattgaagcatggaacaacgttatccaaattctgttgtggtggagaa---gagggag |
130 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||||| ||| |||| |||||| || || || ||||||||||||||| ||| ||||||| || |||| |
|
|
| T |
24998616 |
aagagtttcttcctagcaaggcagcgagggcggttaaaggtgggatcgaagcaaggtacgacattatccaaattctgtggtgatggagaaaaggaaggag |
24998715 |
T |
 |
| Q |
131 |
aagaagttggtgagagttg-agagagatctaataagttgatttgattttgcagtttcctgctggctttgatattctt |
206 |
Q |
| |
|
||| |||||| |||| ||||| |||||||||||||||||||||||||| |||||| |||||||||| ||||| |
|
|
| T |
24998716 |
gtgaaattggtg-ttgttgttgagagttctaataagttgatttgattttgcagcttcctgttggctttgattttctt |
24998791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University