View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13261_low_23 (Length: 251)
Name: NF13261_low_23
Description: NF13261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13261_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 63 - 240
Target Start/End: Complemental strand, 12242897 - 12242721
Alignment:
| Q |
63 |
ttaatgtgttcaaatgatgtggtaatggaaagttatctcttatt-ccatgaaaatgtgtgagtaaatcctattccaaggaataaaaagtacataagcata |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12242897 |
ttaatgtgttcaaatgatgtggtaatggaaagttatctcttatttccatgaaaatgtg--agtaaatcctattcctaggaataaaaagtacataagcata |
12242800 |
T |
|
| Q |
162 |
acacagaagtgaatgacaaggggaacccatttgggttgacttgaaattttaccatgattttgttaaggtttcaggttca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12242799 |
acacagaagtgaatgacaaggggaacccatttgggttgacttgaaattttaccatgattttgttaaggtttcaggttca |
12242721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 34
Target Start/End: Complemental strand, 12242963 - 12242931
Alignment:
| Q |
2 |
aaatattttcaaatgatttaatctagaactttc |
34 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
12242963 |
aaatattttcaaatgatttaatctaaaactttc |
12242931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University