View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_high_16 (Length: 408)
Name: NF13262_high_16
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_high_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 108 - 385
Target Start/End: Complemental strand, 20844306 - 20844036
Alignment:
| Q |
108 |
ttgtaggaatcgtagataaaataaccttatgcacgttacattcataatttttcattctcctaactatatgcaacatgtagataggtggttgtggnnnnnn |
207 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20844306 |
ttgtaggaatcgtgaataaaataaccttatgcacgttacattcataatttttcattcacctaactatatgcaacatgtagataggtggttgtggaatgaa |
20844207 |
T |
|
| Q |
208 |
nnnnnnnncaagatctttgaaagaatttagtagcgttataactgaaactttgaagttcctctacctttgctagccaaccattacctgagtcacctcttgt |
307 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20844206 |
aa------ctagatttttgaaagaatttagtagcgttataactgaaactttgaagttc-tccacctttgctagccaaccattacctgagtcacctcttgt |
20844114 |
T |
|
| Q |
308 |
gataagtcacttggatatggaagtgataaattgtgttggacgaaattttgtataaacttttctttgctttacattttc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20844113 |
tataagtcacttggatatggaagtgataaattgtgttggacgaaattttgtataaacttctctttgctttacattttc |
20844036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 57 - 107
Target Start/End: Complemental strand, 20844388 - 20844337
Alignment:
| Q |
57 |
agtccaaac-ttttgtccaactctagaaaagcaagacaattatgcatgtggt |
107 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20844388 |
agtccaaaccttttgtccaactttagaaaagcaagacaattatgcatgtggt |
20844337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 20844761 - 20844722
Alignment:
| Q |
16 |
acaaaagggagaagagcaattttctagtcgtaatcaatac |
55 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20844761 |
acaaaagggagaagagcaattttctagtcataatcaatac |
20844722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 155
Target Start/End: Original strand, 8467165 - 8467198
Alignment:
| Q |
122 |
gataaaataaccttatgcacgttacattcataat |
155 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
8467165 |
gataaaataaccttatgaacgttacattcataat |
8467198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University