View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_27 (Length: 345)
Name: NF13262_low_27
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 340
Target Start/End: Original strand, 33034272 - 33034611
Alignment:
| Q |
1 |
caatattttgcatcagatactctccaagttcaaaaagaggcaaatggacattggacaggaatcagcagtttttgtaaagtaannnnnnnctattgacttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33034272 |
caatattttgcatcagatactctccaagttcaaaaagaggcaaatggacattggacaggaatcagcagtttttgtaaagtaatttttttctattgacttt |
33034371 |
T |
|
| Q |
101 |
gataagcaattgaaatatattctctaacaccttctggtccaannnnnnnngccatttgtttgttgtcgaaactttgctgccctttttgagtcttagtgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33034372 |
gataagcaattgaaatatattctctaacaccttcttgtccaattttttttgccatttgtttgttgtcgaaactttgctgccctttttgagtcttagtgct |
33034471 |
T |
|
| Q |
201 |
gactgaatgaatgtcttatagtatggtggacagatctatctagcactttacactttagttgaaatacacttctatacatgtgattatatcatctattttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33034472 |
gactgaatgaatgtcttatagtatggtggacagatctatctagcactttacactttagttgaaatacacttctatacatgtgattatatcatctattttt |
33034571 |
T |
|
| Q |
301 |
tcctacaaattattgccgtatctgtgttagtattatgtac |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33034572 |
tcctacaaattattgccgtatctgtgttagtatcatgtac |
33034611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University