View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_31 (Length: 309)
Name: NF13262_low_31
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 987998 - 987732
Alignment:
| Q |
1 |
acatctaaaggtaaaggtgtgtggttagagggaatggaggagaggaggaaaatattttaaatttgactactttttaattcaattatttgaaagatgaaag |
100 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
987998 |
acatctaaggataaaggtgtgtggttagagggaatggaggagaggaggaaaatattttaaatttgactactttttaattcaattatttggaagatgaaag |
987899 |
T |
|
| Q |
101 |
gttaaga----------aaatatctctcaaagtcaattttatctctctttcattagtgaagaatttagaaccgatagaatatttattgcatgtttaaact |
190 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
987898 |
gttaagagaatggaagaaaatatctctcaaagtcaattttatctctctttcattagtgaagaatttagaaccgatagaatatttgttgcatgtttagact |
987799 |
T |
|
| Q |
191 |
tacaaaaatactttggttatatagatttcaacaaactcaacaaattgcatcattttgtaggttgata |
257 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
987798 |
tacaaaaatactttggttacacagatttcaacaaactcaacaaattgcatcattttgtagattgata |
987732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University