View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_33 (Length: 299)
Name: NF13262_low_33
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 8 - 282
Target Start/End: Complemental strand, 56286461 - 56286187
Alignment:
| Q |
8 |
tgagaagaaaacattcagaaacatcatattaatgttttacctcggccaccaatgtcttgctactccaaacaaaggcgccctgaaaacatccagagtataa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
56286461 |
tgagaagaaaacattcagaaacatcatattaatgttttacctcggtcaccaatgccttgctactccaaacaaaggccccctgaaaacatccagagtataa |
56286362 |
T |
|
| Q |
108 |
atctcaattacagatacttgataactgagcaatggaatgcaccagcatttgaaaaggaaattgtgttaacatcatagaaaacttttatttccttagtttg |
207 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
56286361 |
atctcaattacagatacttgataaccgagcaatggaatgcaccagcatttgaaaaggaaatcgtgttaacatcatagaaaactttgatttccttagtttg |
56286262 |
T |
|
| Q |
208 |
cacagattaacaaggagagaacaatagttataattggaaaagaattatgaagaaaattgacaatcaagttgcttc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
56286261 |
cacagattaacaaggagagaacaatagttataattggaaacgaattatgaagaaaattgacaatcaagtggcttc |
56286187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University