View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_38 (Length: 268)
Name: NF13262_low_38
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_38 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 42459 - 42685
Alignment:
| Q |
30 |
aaatctgataaaccggagagaggagtgtgcaacaccttcataacgttctgcaaagcccttaattattttaataaatgtatactgttaagatcatcacata |
129 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42459 |
aaatccgataaaccggagagaggagtgtgcaacaccttcataacgtt--gcaaagtccttaattattttaataaatgtatactgttaagatcatcacata |
42556 |
T |
 |
| Q |
130 |
ggagaatttaataaactactctaaaaatctgcattaaaacattatttatggttgcaattagttatgtaatacattgctaaagggtaaaatttgatatctt |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
42557 |
ggagaatttaataaactactcttgaaatctgcattaatacattatttatggttgcaattagttatgtaatacattgctaattggtgaaattggatatctt |
42656 |
T |
 |
| Q |
230 |
aatgtacaaaaaatataagtataatctac |
258 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
42657 |
gatgtacaaaaaatataagtacaatctac |
42685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University