View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_40 (Length: 255)
Name: NF13262_low_40
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 11 - 200
Target Start/End: Complemental strand, 3280802 - 3280618
Alignment:
| Q |
11 |
cataggacacatagcattcaaaattactttttactaatataataaaaaacataatgaggagcatcaaactttggagttcactattcttgttggattatca |
110 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3280802 |
cataggacacatggcattcaaaattactttt-ac-aatataa---aaaacataatgaggagcatcaaactttggagttcactattattgttggattatca |
3280708 |
T |
 |
| Q |
111 |
ctataaaatagtttcaatatagaaactatgtaaatgaatatcaaacttgaacctgaaaatctagaaaatatttgtcgtaatccttgcaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3280707 |
ctataaaatagtttcaatatagaaactatgtaaatgaatatcaaacttgaacctgaaaatctagaaaatatttatcgtaatccttgcaat |
3280618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University