View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_43 (Length: 245)
Name: NF13262_low_43
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_43 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 43 - 245
Target Start/End: Original strand, 6454587 - 6454791
Alignment:
| Q |
43 |
ggtatatgtaaaagaaag--gttaaatctttaatgtgtattaatccatttagacttggaccaatcaattataggtgagattgatggaaccaatcaatttt |
140 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454587 |
ggtatatgtaaaagaaagaggttaaatctttaatgtgtattaatccatttagacttggaccaatcaattataggtgagattgatggaaccaatcaatttt |
6454686 |
T |
 |
| Q |
141 |
gggtcaagtaggacaatgacctgaaatctcatagcagctcactccccggatgtggatgaaaccgatttcttctccacattgggaggagacaccgatccag |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6454687 |
gggtcaagtaggacaatgacatgaaatctcatagcagctcactccccgaatgtggatgaaaccgatttcttctccacactgggaggagacaccgatccag |
6454786 |
T |
 |
| Q |
241 |
gcacc |
245 |
Q |
| |
|
||||| |
|
|
| T |
6454787 |
gcacc |
6454791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University