View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13262_low_50 (Length: 226)

Name: NF13262_low_50
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13262_low_50
NF13262_low_50
[»] chr8 (1 HSPs)
chr8 (101-141)||(20895326-20895366)


Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 101 - 141
Target Start/End: Original strand, 20895326 - 20895366
Alignment:
101 gcctatctattggagccagaatcataatcttaaagtcggtg 141  Q
    |||||||||| ||||||||||||||||||||||||||||||    
20895326 gcctatctatcggagccagaatcataatcttaaagtcggtg 20895366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University