View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_53 (Length: 215)
Name: NF13262_low_53
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 2407882 - 2408061
Alignment:
| Q |
18 |
gttttagcagataatttaagttgcactttgctgttgtagttgttgtcactatgaatgtttccctacacaatattttgaggaagtttcagccactgtcttt |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2407882 |
gttttagcagataatataagttgcactttgctgttgtagttgttgtcactatgaatgtttccctacacaatattttgaggaagtttcagccactgtcttt |
2407981 |
T |
|
| Q |
118 |
aaaaaacacacattaagcaagcagtaattcaggtgcttagcaataagcaggaccttatgtgcattaacttacagtatgat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2407982 |
aaaaaacacacattaagcaagcagtaattcaggtgcttagcaataagcaggaccttatgtgcattaacttacagtttgat |
2408061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University