View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13262_low_55 (Length: 213)
Name: NF13262_low_55
Description: NF13262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13262_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 45 - 198
Target Start/End: Complemental strand, 7832281 - 7832128
Alignment:
| Q |
45 |
atgcttccccaaaacctccctttgttcggtttgataatgttgggacaagagagtgtgaagtttgggttcccttttcagagtaagggatttgtattacttt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7832281 |
atgcttccccaaaacctccctttgttcggattgataatgttgggacaagagagtgtgaagtttgggttcccttttcagactaagggatttgtattacttt |
7832182 |
T |
 |
| Q |
145 |
tgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7832181 |
tgaaggaataaaaggttcctatgtttgaaatagtttcaaaaagattggtctctg |
7832128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University