View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13263_low_20 (Length: 237)
Name: NF13263_low_20
Description: NF13263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13263_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 74 - 237
Target Start/End: Complemental strand, 30344119 - 30343956
Alignment:
| Q |
74 |
taaaccaacgggtgatagtaatgacttaacacactgacaaattgcattgtttaagaacattgctgctttgtcatctattttgtttgtgtgtattgtatag |
173 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30344119 |
taaaccaacgggtgataataatgacttaacacactgacaaattgcattgtttaagaacattgctgctttgtcatctattttgtttgtgtgtattgtatag |
30344020 |
T |
 |
| Q |
174 |
tgctttcactttttgattcttttcctgattcctaatgctaaaattaacaaaaacgattcataat |
237 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30344019 |
tgcattcactttttgattcttttcctgattcctaatgctaaaattaacaaaaacgattcataat |
30343956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University