View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13263_low_9 (Length: 395)
Name: NF13263_low_9
Description: NF13263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13263_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 3707395 - 3707615
Alignment:
| Q |
9 |
gagaagaatcgttggaagtataaatgagcaattaccactctacaa-------agggtttcggctcccaaagcnnnnnnntggtctgatgggcttcaaatg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| | | ||||||||||| |
|
|
| T |
3707395 |
gagaagaatcgttggaagtataaatgagcaattaccactctacaacaattgaagggtttcggctcccaaagcaaaaaaatggtccggtaggcttcaaatg |
3707494 |
T |
 |
| Q |
102 |
aatacactcttaaagcttctttgtctatacctgcaaaaatcataggataatactttgatggtttctatccctaccttctggtttttcgcacgccctacag |
201 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3707495 |
aatacactcttaa-gtttctttgtctatacctgcaaaaatcataggataatactttgatggtttctatccctacctattggtttttcgcacgccctacag |
3707593 |
T |
 |
| Q |
202 |
atttttagattacataatccgg |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3707594 |
atttttagattacataatccgg |
3707615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 336 - 395
Target Start/End: Original strand, 3707728 - 3707788
Alignment:
| Q |
336 |
catgaaataagttcaaatgattgatttcccct-aaagaaaaagttcgaatgaatgatagtt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
3707728 |
catgaaataagttcaaatgattgatttcccctaaaaaaaaaagttcgaatgaatgatagtt |
3707788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University