View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13264_high_6 (Length: 257)
Name: NF13264_high_6
Description: NF13264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13264_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 21 - 247
Target Start/End: Original strand, 30136059 - 30136285
Alignment:
| Q |
21 |
agtatgatcatagaaatatttcattatatgcattcgacataatggaaaaatcgtattgttacttacaacatttcaatgtgttgcacggattaaaatacac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30136059 |
agtatgatcatagaaatatttcattatatgcattcgacataatggaaaaatcgtattgttacttacaacatttcaatgtgttgcacggattaaaatacac |
30136158 |
T |
 |
| Q |
121 |
actgcagtgaatctaagatgcctaaaaattaagagaaaatttgatgttgacagcttttttgttgtccaacaccgtatataaataccgcataaatattatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30136159 |
actgcagtgaatctaagatgcctaaaaattaagagaaaatttgatgttgacagcttttttgttgtccaacaccgtatataaataccgcataaatattatt |
30136258 |
T |
 |
| Q |
221 |
tcattttttgattagttttcttctctc |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30136259 |
tcattttttgattagttttcttctctc |
30136285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 72
Target Start/End: Original strand, 30135958 - 30135994
Alignment:
| Q |
36 |
atatttcattatatgcattcgacataatggaaaaatc |
72 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||| |
|
|
| T |
30135958 |
atatttcattatatgcattcgacatgatcgaaaaatc |
30135994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University