View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13264_low_5 (Length: 374)
Name: NF13264_low_5
Description: NF13264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13264_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 17 - 363
Target Start/End: Complemental strand, 47113170 - 47112825
Alignment:
| Q |
17 |
attgaagaccgggggtcttatgatgaaattagaagataatgttggagagtcttcttctataaatgttgatatgaagtcaaacccaatagtagataagtcg |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47113170 |
attgaagaccgagggtcttatgatgaaattagaagataatgttggagagtcttcttctataaatgttgatatgaagtcaaccccaatagtagataagtcg |
47113071 |
T |
|
| Q |
117 |
aatgtggttggcagatgtggtgatcatcatcctaccatcaaggaagaagcttgattttaatttgtttaagctttaaagttctgcatgtttatcactgtcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47113070 |
aatgtggttggcagatgtggtgatcatcatcctaccatcaaggaagaagcttgattttaatttgtttaagctttaaagttctgcatgtttatcactgtcc |
47112971 |
T |
|
| Q |
217 |
tttttcagtctataagtttactctccannnnnnnnnngttgagatgttccaatttaagttattacaattatacttttatatataagggtattggtttaag |
316 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47112970 |
tttttcggtctataagtttactctcca-tttttttttgttgagatgttccaatttaagttattacaattatacttttatatataagggtattggtttaag |
47112872 |
T |
|
| Q |
317 |
ttttattttgttagttgtcaaattgtcattatttatatattttctct |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47112871 |
ttttattttgttagttgtcaaattgtcattatttatatattttctct |
47112825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University