View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13264_low_8 (Length: 239)
Name: NF13264_low_8
Description: NF13264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13264_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 10 - 222
Target Start/End: Complemental strand, 48892899 - 48892693
Alignment:
| Q |
10 |
gattatactgaataacgtcgttttctcaatttattattggtgtcggtgtgtttgtgtcgtatcctacatcacattttttggacaaaacaaatattagtat |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48892899 |
gattatactgaattacgtcgttttctcaatttattattggtgtcagtgtgtttgtgtcgtatcctacatcacattttttggacaaaacaaatattag--- |
48892803 |
T |
 |
| Q |
110 |
atatactagtagtagttggttgatattttctgtgtcactaatgtttgaacctagatccttaatttatctcc--tgtaagacttagcaaccttacgtgaaa |
207 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48892802 |
-tatactagtagtagtttgttgatattttctgtgtcactaatgtttgaacctagttcc----tttatctcctgtgtaagacttagcaaccttacgtgaaa |
48892708 |
T |
 |
| Q |
208 |
aaatgggttggtggt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48892707 |
aaatgggttggtggt |
48892693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University