View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13265_low_11 (Length: 364)
Name: NF13265_low_11
Description: NF13265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13265_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 179 - 349
Target Start/End: Complemental strand, 45981337 - 45981167
Alignment:
| Q |
179 |
catgaagtgtcaagaaatttcattctaaggaaataggataattcccccaaatctttcatctcaaactcagacatcatgatataggtgaaacatagaccaa |
278 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45981337 |
catgaagtgtcaagaaatttcattttaaggaaataggataattcccccaaatctttcatctcaaactcagacatcatgatataggtgaaacatagaccaa |
45981238 |
T |
 |
| Q |
279 |
acttttgcacttgctaaggaaaccgctaatgtgcatgtttcagtccttgccgtttgtgcatacacttatca |
349 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45981237 |
acttttgcacttgctaaggaaaccgttaatgtgcatgtttcagtccttgccagttgtgcatacacttatca |
45981167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 13 - 147
Target Start/End: Complemental strand, 45981468 - 45981334
Alignment:
| Q |
13 |
tgaaatgaagagttgtgatgccgcttagtgaggaagaagaattttagtttttgtcttgttttctatctttagtttgtcatgtccctgtaacagtattaca |
112 |
Q |
| |
|
||||| ||| |||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| ||||| |
|
|
| T |
45981468 |
tgaaacgaaaagttgtgatgtcgtttagtgaggaagaagaattttagtttttatcttgttttctatctttagcttgtcatgtccctacaacagttttaca |
45981369 |
T |
 |
| Q |
113 |
atcaaacattatacaactgttatcgtcgtgtcatg |
147 |
Q |
| |
|
||| ||||||||| ||||||| | ||||||||||| |
|
|
| T |
45981368 |
atcgaacattatataactgttgttgtcgtgtcatg |
45981334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 269 - 329
Target Start/End: Complemental strand, 45991912 - 45991852
Alignment:
| Q |
269 |
catagaccaaacttttgcacttgctaaggaaaccgctaatgtgcatgtttcagtccttgcc |
329 |
Q |
| |
|
|||||||||| || ||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
45991912 |
catagaccaacctcttgcacttgctaaggaacccactagcctgcatgtttcagtccttgcc |
45991852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University