View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13266_high_8 (Length: 257)
Name: NF13266_high_8
Description: NF13266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13266_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 3635436 - 3635680
Alignment:
| Q |
1 |
tccattgcattgtttggtcctttgattggaacatgggttgataagttgacttatgtgaaggtgtgatcccaatatttgttatctcttctttttatgcaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3635436 |
tccattgcattgtttggtcctttgattggaacatgggttgataagttgacttatgtgaaggtgtgatcccaatatttgttatctcttctttttatgcaag |
3635535 |
T |
 |
| Q |
101 |
tacttgcgctataatttaattatcattgttaaatgggtacaacaaaaagttagttttataaaatattattggatagtatagatatatctttgaactaatc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3635536 |
tacttgcactataatttaattatcattgttaaatgggtacaacaaaaagttagttttataaaatattattggatagtatagatatatctttgaactaatc |
3635635 |
T |
 |
| Q |
201 |
gaggttttaaatcgcggttgcagttgtatctagttccttaatatt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3635636 |
gaggttttaaatcgcggttgcagttgtatctagttccttgatatt |
3635680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 3644868 - 3644939
Alignment:
| Q |
1 |
tccattgcattgtttggtcctttgattggaacatgggttgataagttgacttatgtgaaggtgtgatcccaa |
72 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3644868 |
tccattgcattgtttggtcccataattggaacatgggttgataagttgacttaccaaaaggtgtgatcccaa |
3644939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University